Introduction
The main features of acute lung injury (ALI) are acute, progressive respiratory failure and hypoxemia, which are typical clinical manifestations of thoracic diseases.1–3 During the outbreak of the 2019 novel coronavirus disease (COVID-19), SARS-CoV-2 infection induced the excessive activation of immune cells in the body’s lungs,4,5 and this led to the development of ALI.
The response of ALI to severe pulmonary microbial infections is the result of the immune recognition of pathogens responsible for the induction of pro-inflammatory immune responses.6 ALI leads to severe tissue damage, and in severe cases, irreversible lung damage, leading to death.7,8 Macrophages are the most abundant immune cells in healthy lungs, and are essential for maintaining lung homeostasis.9,10 Macrophage dysregulation in the lungs is the major cause of inflammation in bacterial and viral infections, and a key factor in the pathogenesis of ALI and acute respiratory distress syndrome, including the involvement of cytokine storms.11 For example, macrophages in Gram-negative bacterial pneumonia produce tumor necrosis factor-alpha (TNF-α), which induces granulocyte-macrophage colony-stimulating factor in alveolar epithelial cells, and proliferative signals through autocrine stimulation, thereby contributing to the impaired recovery of alveolar epithelial cells.12
Qingfei Paidu decoction (QFPD) was created by Ge You-wen, a distinguished researcher of the Chinese Scientists of Traditional Chinese Medicine, based on the core pathogenesis of COVID-19, combined with classic prescriptions in the “Treatise on Febrile and Miscellaneous Diseases”, which include the Maxing Shigan Decoction, Shegan Mahuang Decoction, Xiaochaihu Decoction, and Wuling Powder.13 This was listed in the Chinese Pharmacopoeia (2015 Edition), and is helpful for the prevention and treatment of influenza H1N1 and hand-foot-and-mouth disease.14 Furthermore, QFPD is useful for treating COVID-19, and is recommended for SARS-CoV-2 infection.15 The complement signaling pathway can be activated in three different ways: classical pathway, lectin pathway, and alternative pathway.16 This plays an important role in systemic inflammatory response.17–19 After binding to its receptor, this can activate its effector, and induce the production of inflammatory cytokines.18,20 The present study determined the role of QFPD in lipopolysaccharide (LPS)-induced ALI through a suite of cell experiments and animal experiments. This will provide a practical basis and directional guide for the further exploration of the use of QFPD for treating ALI.
Materials and methods
QFPD components and preparation of the drug-containing serum
QFPD comprises of 21 traditional Chinese herbs: Ephedra 9 g, Radix glycyrrhizae 6 g, Almonds 9 g, raw gypsum 15g, Ramulus Cinnamomi 9 g, Rhizoma alismatis 9 g, Polyporus umbellatus 9 g, Atractylodes japonica Koidzumi 9 g, Poria 15 g, Bupleurum 16 g, Scutellaria 6 g, Ginger-processed Pinellia 9 g, Ginger 9 g, Radix et Rhizoma Asteris 9 g, Flos Farfarae 9 g, Rhizoma Belamcandae 9 g, Radix et Rhizoma Asari 6 g, Rhizoma Dioscoreae 12 g, Fructus Aurantii Immaturus 6 g, Pericarpium Citri Reticulatae 6 g, and Herba Agastachis 9 g. Gypsum was initially decocted with 250 mL of water for 30 minutes. Then, the remaining herbs were mixed with 500 mL of water, and steeped for 30 minutes. The water decoction was prepared according to the traditional method. In the present study, the doses administered to mice were converted based on human clinical doses.
All animal studies were approved by the Institutional Animal Care and Use Committee of Shandong First Medical University & Shandong Academy of Medical Sciences (SMBC21LL028). Mice (Wistar, male, 280 g; Pengyue, Jinan, China) were gavaged with QFPD (3.6 mL) or saline for six consecutive days. At one hour after the last gavage, the mice in each group were anesthetized with 2% pentobarbital sodium (0.2 mL/100 g). Then, blood was drawn from the abdominal aorta, held at 37°C for one hour, and centrifuged at 2,000 rpm for five minutes to collect the serum. Afterwards, the serum was inactivated at 56°C, filtered, and stored at −20°C for back-up.
High performance liquid chromatography
Initially, appropriate amounts of chlorogenic acid, amygdalin, geniposide, hesperidin, baicalin, liquiritin and ammonium glycyrrhetate reference substance were taken, and the mixed reference substance solution was prepared by adding the methanol solution. Then, 5 mL of QFPD was extracted by ultrasonic extraction with 4 mL of methanol, and centrifuged at 2,000 rpm for 10 minutes. Afterwards, the supernatant was taken and filtered through a 0.22 µm filter membrane to obtain the QFPD sample solution. The above-mentioned mixed reference solution and QFPD test solution were determined by high performance liquid chromatography. The chromatographic conditions were, as follows: 0.1% phosphoric acid water and acetonitrile as the mobile phase, 210 nm detection wavelength, column temperature at 25°C, flow rate at 0.8 mL/min, and injection volume of 5 µl.
Cell culture, isolation and stimulation
The peritoneal macrophages were isolated and cultured, as previously described.21 Briefly, eight-week-old male C57 mice (Pengyue, Jinan, China) were intraperitoneally (i.p.) injected with 1 mL of 3% mercaptoacetic acid salt once a day for three consecutive days, and the peritoneal macrophages were obtained from these mice. Then, 5 mL of pre-cooled phosphate buffered saline (PBS) was injected into the peritoneal cavity, and the peritoneal lavage solution was repeatedly rinsed twice. Afterwards, the lavage solution was centrifuged at 1,000 r/min for 10 minutes in room temperature, and the resulting cell precipitates were re-inoculated with 10% RPMI 1640 culture solution. Subsequently, the macrophages were purified using RPMI 1640 (Gibco Life Technologies), and lavaged twice with PBS (Solarbio, Beijing, China) after four hours of adherence. The remaining adherent cells were macrophages, and these were cultivated in RPMI at 37°C and 5% CO2. Before treatment with the QFPD-containing serum or siRNA, the peritoneal macrophages were cultured in DMEM, which contained 2% fetal bovine serum, overnight. Then, these were stimulated with LPS (1 µg/mL; Sigma-Aldrich, St. Louis, MO, USA), and used to induce cell inflammation.
Cell viability assay
Cell viability was measured using Cell Counting Kit-8 (CCK-8; Solarbio, Beijing, China). Briefly, macrophages were seeded in a 96-well plate, and allowed to adhere overnight. Then, the cells were treated with LPS, with or without QFPD, for 24 hours. Afterwards, 10 µL of CCK-8 solution was added and incubated at 37°C for one hour. Subsequently, a microplate reader (SpectraMax ID3, Shanghai, China) was used to measure the absorbance at a wavelength of 450 nm.
Nitric oxide (NO) detection
Macrophages were seeded in a 6-well plate, and allowed to adhere overnight. Then, after cells were administered with LPS, with or without QFPD, for 24 hours, the culture supernatants were collected and centrifuged at 1,000 g for three minutes to remove the floating cells. Afterwards, the NO level of the culture supernatants was detected using a NO detection kit (Beyotime Biotechnology, Shanghai, China), and the absorbance was measured at 550 nm using a microplate reader.
Animals and treatment
ALI was established through a single i.p. injection of LPS (15 mg/kg). After four hours, a subset of mice was sacrificed for serum collection. At eight hours after induction, the other part of each of the mouse’s left bronchus was ligated and perfused with saline (1 mL) into the right lung lobe to obtain the bronchoalveolar lavage fluid (BALF). The serum and BALF collected above were subjected to multi-cytokine analysis, and the left lung was fixed with paraformaldehyde for histological analysis. In order to analyze the effect of QFPD on the survival time of cytokine storm syndrome (CSS) model mice, the i.g. injection of saline (n = 10) or QFPD (0.8 mL) was performed before the i.p. injection of the lethal dose of LPS (30 mg/kg) to mice. Mice survival was recorded every two hours, up to 40 hours. All animal studies were approved by the Institutional Animal Care and Use Committee of Shandong First Medical University & Shandong Academy of Medical Sciences (SMBC21LL028).
Lung wet/dry (W/D) ratio
The W/D weight ratio was determined to measure the lung tissue edema. Briefly, the whole lung was harvested, the surface water was allowed to dry, and the wet weight was measured. Then, the baseline dry weight of the lung was calculated by heating the lung tissue in a thermostatic oven at 80°C for 48 hours.
Quantitative real-time polymerase chain reaction (qRT-PCR) and enzyme-linked immunosorbent assay (ELISA)
The total RNA was isolated from cultured cells using TRIzol reagent (Vazyme, Nanjing, Jiangsu, China) for reverse transcription using the ReverTra Ace qPCR RT Kit (TOYOBO, Shanghai, China). Then, qRT-PCR was carried out using the Light-Cycler 480 (Roche, Basel, Switzerland), and the primers created through BGI (Beijing, China). The primer sequences are listed in Table 1. The secreted levels of C3a, C5a and C5b-9 (Elabscience, Wuhan, Hubei, China), and inflammatory cytokines in the culture supernatants and serum were measured using ELISA kits (Hangzhou Multi-Science Company, Hangzhou, Zhejiang, China).
Table 1All primers used for the study
| Gene names | Primer sequence (5′-3′) | GeneBank accession no. | Product size (bp) |
|---|
| MCP-1 | TAAAAACCTGGATCGGAACCAAA | NM_011333 | 120 |
| IFN-γ | ATGAACGCTACACACTGCATC | NM_008337 | 182 |
| VEGF-β | CTTCAATACGTCAGACATTCGGG | NM_011577 | 142 |
| CXCL2 | CCAACCACCAGGCTACAGG | NM_002089.4 | 108 |
| TNF-α | CCTGTAGCCCACGTCGTAG | NM_013693 | 148 |
| IL-1β | GAAATGCCACCTTTTGACAGTG | NM_008361 | 116 |
| MMP3 | TCTGGGCTATACGAGGGCAC | NM_010809 | 232 |
| MMP9 | GCAGAGGCATACTTGTACCG | NM_013599 | 229 |
| GAPDH | AGGTCGGTGTGAACGGATTTG | NM_008084 | 95 |
Small interfering RNA (siRNA) transfection and RNA sequencing
Small interfering RNA (siRNA, Table S1) against C3, C1s, CFD and MASP2, and the negative control (Ruibo, Guangzhou, China) were transfected to the macrophages using transfection reagents (Polyplus-transfection, Strasbourg, France). For the RNA sequencing, the LPS-activated macrophages were treated with QFPD for 24 hours. Then, the total RNA was collected to construct the cDNA library for the RNA transcriptome sequencing through LC-BIO Technologies Co., Ltd. (Hangzhou, Zhejiang, China).
Western blot
After LPS-activated macrophages were treated with QFPD-medicated serum for 24 hours, these macrophages were washed with PBS for three times, and the protein components were extracted using radioimmunoprecipitation assay lysate and phenylmethanesulfonyl fluoride (100:1). The protein concentration was detected using the Bradford Protein Assay Kit (Beyotime Biotechnology, Shanghai, China). The primary antibodies against BAX (50599-2-Ig, 1:5,000), Bcl2 (26593-1-AP, 1:2,000), GAPDH (60004-1-Ig, 1:5,000), and caspase-3 (19677-1-AP, 1:1,000) were purchased from Proteintech (Wuhan, Hubei, China). The cleaved-caspase-9 (#7237P, 1:1,000), cleaved-caspase-7 (#8438P, 1:1,000), and BAK (#6947P, 1:1,000) were purchased from Cell Signaling (Danfoss Town, Boston, Massachusetts, USA). Sodium dodecyl-sulfate polyacrylamide gel electrophoresis (SDS-PAGE) was performed to separate the samples, and these were transferred onto polyvinylidene difluoride membranes for visualization using the ECL Plus detection system (Thermo Scientific, Waltham, MA, USA).
TdT-mediated dUTP nick-end labeling (TUNEL) staining
The left lung lobes of mice were fixed with 4% paraformaldehyde (Solarbio, Beijing, China). Then, the tissues were embedded in paraffin, sliced, and stained with TUNEL (Solarbio, Beijing, China), according to manufacturer’s instructions. Afterwards, these were incubated with 4′,6-diamidino-2-phenylindole (DAPI; Beyotime Biotechnology, Shanghai, China) to identify the nucleus. Subsequently, the cells were observed using a laser scanning confocal microscope (Olympus, Japan).
Immunofluorescence (IF)
After the LPS-activated macrophages were treated with QFPD-medicated serum for 24 hours, these were fixed for 15 minutes in room temperature (RT), and treated with the immunochromatin penetrant (Beyotime Biotechnology, Shanghai, China) for 30 minutes in RT. After blocking with the QuickBlacktm Immunochrome blocking solution (Beyotime Biotechnology, Shanghai, China) for one hour, the cells were incubated overnight with the primary antibody at 4°C. On the second day, these cells were allowed to rewarm for one hour at 37°C, incubated with the secondary antibody for one hour, and subsequently incubated with DAPI to identify the nucleus. Then, these cells were observed by laser scanning confocal microscopy.
Histological analysis
The lung lobes were fixed with 4% paraformaldehyde, or the paraffin embedment sections (5 µm) obtained from formalin-fixed tissues were stained with hematoxylin and eosin (H&E; Solarbio, Beijing, China), and were photographed using a microscope (Olympus, Tokyo, Japan).
Tissue immunofluorescence
The mice lung lobes were fixed with 4% paraformaldehyde and paraffin-embedded, and the tissue sections (5 m) were formalin-fixed. Then, the paraffin sections were dewaxed and hydrated, and antigen repair was performed using the sodium citrate-EDTA antigen repair solution (Beyotime Biotechnology, Shanghai, China) for 20 minutes after blocking with 5% BSA (Solarbio, Beijing, China) for one hour. Afterwards, the sections were incubated with the primary antibody overnight at 4°C. On the second day, the sections were allowed to rewarm for one hour at 37°C, cultured with the secondary antibody for one hour at 37°C, and incubated with DAPI to identify the nucleus. The cells were observed by laser scanning confocal microscopy.
Network pharmacology analysis
The active ingredients of the herbs in QFPD were collected from the Traditional Chinese Medicine Systems Pharmacology Database and Analysis Platform (TCMSP, old.tcmspe.com/tcmsp.php).22 The obtained components were filtered, as follows: 180 ≤ molecular weight ≤500, dehydration partition coefficient <5, bioavailability (OB) ≥30%, and drug-like property ≥0.18.23–26 The targets for each component were predicted using the PharmMapper (lilab-ecust.cn/pharmmapper/)27 and TargetNet database (targetnet.scbdd.com/calcnet/index/).28 Duplicate targets were removed after merging.
The ALI-related targets were collected using “acute lung injury” as the keyword from the GeneCards database (www.genecards.org/),22,28 Online Mendelian Inheritance in Man database (www.omim.org/),22 and Therapeutic Target Database, db.idrblab.net/ttd). The online mapping platform Venny 2.129,30 was used to map the targets of the effective components of QFPD and disease targets of ALI, and a Venn diagram was drawn to indicate the relationship between each target set, with the overlapping region potentially including the key targets for QFPD to treat ALI. Next, the common targets were uploaded into the STRING database,30,31 multiple proteins were selected, and Homo sapiens were selected as the species. Then, the interaction between target proteins was analyzed, and a network diagram for the protein-protein interaction (PPI) was obtained. The Cytoscape 3.9.1 software was used for visualization.32
Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analysis
The identified gene targets for QFPD (refer to section 2.15) were copied to the list of the DAVID database (david. ncifcrf.gov/tools.JSP),33 the marker official_gene_symbol was selected, and Homo sapiens were annotated for the GO TERM (biological process [BP], cellular component [CC], and molecular function [MF]), enrichment analysis, and KEGG pathway annotation analysis of target proteins. The key GO and KEGG pathways were identified using p < 0.05 as the criterion. Cytoscape 3.9.1 was used to construct the drug-herb-active compound network.
Statistical analysis
The data was presented as mean ± standard deviation. The “n” represented the number of independent experiments performed in mouse peritoneal macrophages (n = 6) for the cell experiments. Using randomization and blind analysis, all animal experiments were designed to generate groups of equal size (n = 9). One-way analysis of variance (ANOVA) was used to compare multiple groups. Statistical significance was set at p < 0.05. Analysis and graphing were performed using the GraphPad Prism 8.0 software (San Diego, CA, USA).
Results
Therapeutic effects of QFPD on LPS-induced ALI in mice
The therapeutic impact of QFPD on ALI was assessed using the LPS-induced mouse model. Before the experiment, the fingerprint of the synthesized QFPD was initially established (Fig. S1). Then, QFPD was consecutively administered for three days before LPS injection, and the serum was collected at four hours following LPS injection for further analysis. Twelve cytokines were simultaneously measured by ELISA. Compared to the controls, the production of five cytokines (Interleukin-6 (IL6), interferon-gamma (IFN-γ), chemokine monocyte chemoattractant protein-1 (MCP-1), TNF-α and interleukin 1 beta (IL1β)) significantly decreased after the QFPD treatment (Fig. 1a).
In order to assess the inflammation status in the lungs, ELISA was performed to examine the production of 12 cytokines in BALF at eight hours after LPS stimulation. The secreted levels of six cytokines (IFN-γ, MCP-1, IL6, TNF-α, IL1β and granulocyte-macrophage colony-stimulating factor) significantly decreased after QFPD treatment, when compared to the parental controls (Fig. 1b). The histological analysis revealed alveolar damage in animals that were given LPS (i.p.) injections, which included inflammatory cell infiltration (orange arrow), congestion (blue arrow), and edema within thickened alveoli (black arrow) (Fig. 1c). However, the above pathological parameters were all ameliorated by the QFPD treatment.
Next, the lung injury scores were calculated (Fig. 1d), and the protective effects of QFPD were observed when the score was 2.6 ± 0.61, when compared to the control group (score: 4.8 ± 0.33). Furthermore, the QFPD treatment prolonged the survival time of mice that received the i.p. injection of the lethal dose of LPS (30 mg/kg), when compared to the controls (Fig. 1e). The lung W/D ratio was used to measure the effects of QFPD in pulmonary edema. As shown in Figure 1f, the lung W/D ratio significantly increased in the LPS-treated group, when compared to the control group, while this increase was reduced by the QFPD treatment. The routine blood test revealed that the exposure to LPS led to the increase in granulocytes and decrease in lymphocytes, when compared to the parental controls. Obviously, after treatment with QFPD, the above changes were all restored (Table S2).
QFPD alleviates the lung injury by inhibiting inflammation and apoptosis
Mouse peritoneal macrophages were used to analyze the anti-inflammatory potential of QFPD. In order to obtain the optimal concentration of QFPD, cell counting was initially performed using the CCK-8 kit. As shown in Figure 2a, low concentrations of drug-containing serum did not have a significant effect on the growth of peritoneal macrophages. When the concentration of drug-containing serum was at 15%, the cell proliferation started to be inhibited. Consequently, 10% QFPD-medicated serum was chosen for the subsequent cellular assay.
As reported by previous studies, LPS (1 µg/mL) was used to stimulate macrophages to mimic the acute inflammation, and this evidenced by the sharp increase in TNF-α secretion in macrophages (Fig. 2b). However, the increase was mostly reversed after the QFPD treatment. Similar effects were observed by analyzing the production of MCP-1, IFN-γ, vascular endothelial growth factor-β (VEGF-β), IL1β, matrix metallopeptidase (MMP)-9 and C-X-C Motif Chemokine Ligand 2 (CXCL2). In order to examine the effect of QFPD on NO production, the cells were pretreated with QFPD for one hour, and subsequently stimulated with LPS (1 µg/mL) for another 24 hours. Consistently, the increase in NO production caused by the LPS stimulation was attenuated by the QFPD treatment (Fig. 2c).
During an inflammation response, the excessive production of pro-inflammatory cytokines can induce the apoptosis of inflammatory cells (Karki et al., 2021).4 In order to determine whether QFPD can modulate the apoptosis of pulmonary cells in LPS-exposed lungs, the expression of apoptosis-associated proteins was detected by IF. As shown in Figure 3a, the LPS-treated group exhibited an increase in caspase-3 and BAX expression, and a decrease in BCL-2 expression, when compared to the control group. In contrast, the QFPD treatment prevented this trend within four hours after LPS exposure. In addition, the inhibition of LPS-induced apoptosis by QFPD was identified by TUNEL assay (Fig. 3b). Furthermore, the induction of apoptosis through the challenge of LPS was confirmed by western blot analysis, showing the increase in Bax, caspase-3 and cleaved caspase-9, and the decrease in Bcl-2 in lung tissues (Fig. 3c) and macrophages (Fig. 3d). As expected, the above parameters were all restored after QFPD treatment, suggesting the protective role of QFPD against the LPS-induced apoptosis of pulmonary tissue cells.
QFPD treatment induces an altered molecular signature in immune cells
In order to determine the possible mechanisms underlying the therapeutic effects of QFPD in ALI, transcriptome sequencing (RNA-seq) analysis was performed to identify the differentially expressed genes (DEGs) in LPS-activated macrophages versus LPS-activated macrophages plus QFPD treatment.
A total of 182 genes were identified to be significantly differentially expressed (Fig. 4a), and the enrichment analysis of the GO classification and KEGG pathways was conducted to identify the associated biological processes. The DEGs were enriched in the complement component C5a signaling pathway, complement component C5a receptor activity, inflammatory response, positive regulation of cytosolic calcium ion concentration, cellular response to lipopolysaccharide, and regulation of IL8 production (Fig. 4b and d). The KEGG analysis revealed that the DEGs were mainly involved in nitrogen metabolism, cysteine, and methionine metabolism, the complement and coagulation cascades, and the IL17 signaling pathway (Fig. 4c).
Pharmacological analysis results for the QFPD Network
A total of 819 genes related to ALI were collected from the GeneCards, Therapeutic Target Database, and Online Mendelian Inheritance in Man data collection databases. By employing three available resources, namely, the PharmMapper, TargetNet, and SwissTargetPrediction databases, a total of 362 unique targets were finally collected. Then, the above potential target genes of QFPD were intersected with the targets of ALI, and it was identified that 52 genes may be associated with the effects of the QFPD treatment in ALI (Fig. 5a). Subsequently, these 52 overlapping targets were imported into the STRING database to build the PPI network (Fig. 5b), and visualized using Cytoscape. Using this network, 10 core targets were obtained: TNF, EGFR, NR3C1, AR, NOS3, MAPK14, GRIN2B, RELA, MMP9 and HTR2A (Fig. 5c). The molecular docking of core targets was also performed (Fig. S2). These targets may be regarded as the primary action targets of QFPD for the therapy of ALI. The discovery of these targets demonstrates that QFPD treats ALI through a variety of potential targets.
The names of the active ingredients of QFPD (Table S3) were imported into the Cytoscape software to build a drug-ingredients network diagram (Fig. 5d). In addition, the compounds and associated targets from the QFPD formula were imported to Cytoscape to create a compound-target network map (Fig. 6a). The Cytoscape software Network Analyzer plug-in was used to generate and assess the network’s topological parameters from the standpoint of network node relevance. Then, degree was selected as a measurement of node importance, in which degree referred to the number of edges associated with a node. Thus, a larger node meant more importance. According to the degree analysis, the top six compounds were, as follows: MOL005918 (phenanthrene), MOL000822 (polyporusterene G), MOL006129 (6-methylgingediacetate2), MOL004948 (isoglycyrol), MOL005890 (pachypodol), and MOL001689 (acacetin).
The R programming language and DAVID database were used for the GO enrichment analysis of the above-mentioned QFPD targets to treat COVID-19. The top 20 enriched categories, which include BP, CC and MF, are listed in Figure 6b. For BP, the target genes were involved in the following areas: regulation of cytokine production, apoptotic signaling pathway, angiogenesis, vasculature development, and response to xenobiotic stimulus. For CC, the targets were enriched in the membrane raft, membrane microdomain, postsynaptic membrane, and others. For MF, the target genes were extensively involved in the following areas: amine binding, serotonin binding, nuclear receptor activity, ligand-activated transcription factor activity, transcription coactivator binding, and nuclear receptor activity. The KEGG result included 53 pathways (Fig. 6c), such as the AGE-RAGE signaling pathway in diabetic complications, alcoholic liver disease, complement and coagulation cascades, COVID-19, and diabetic cardiomyopathy.
Complement factors are required for the anti-ALI effects of QFPD
The RNA-seq analysis and network pharmacology suggested that the complement-related pathway is important for the QFPD-mediated anti-inflammatory effect in ALI. The levels of complement components were measured in the serum and supernatant obtained from the cell culture by ELISA. The data revealed that after the LPS challenge, the production of C3a, C5a and C5b-9 significantly increased, while this induction was significantly reduced after QFPD was simultaneously introduced (Fig. 7a and b). Furthermore, the expression level of C5aR in pulmonary cells was measured by IF assay through counterstaining with F4/80 to mark the macrophages. A similar inhibitory effect of QFPD on the C5aR expression was also observed (Fig. 7c and d).
In order to further ascertain that the therapeutic effect of QFPD on ALI is mediated by the complement pathway, siRNAs that target C3, C1s, CFD and MASP2, which are the key molecules of the complement pathway, classical pathway, bypass pathway, and lectin pathway, respectively (Polycarpou et al., 2020),34 were transfected to the macrophages. After LPS exposure, the silencing of the above complement factors restored the disturbance of apoptosis-associated proteins (Fig. 8a), and reduced the production of inflammatory factors (Fig. 8b–d). However, no obvious synergistic reduction in inflammatory factors and apoptosis was observed when the macrophages were treated by QFPD plus siRNA targeting C3 or C1s (Fig. 8a–d). Therefore, these results suggest that the classical pathway of complement factors is required for QFPD to achieve its therapeutic role in reducing inflammatory response and cytokine storm production, and protecting against ALI.
Discussion
The direct inhibition of the massive release of cytokines from hyperactivated immune cells serves as a therapeutic strategy for ALI and SARS-CoV-2 infection.35 To date, traditional Chinese medicine, including QFPD, has been widely used for the treatment of patients with COVID-19.36 Compared to modern medicines, herb-based TCMs have exhibited several merits, including pronounced curative effects, fewer side effects, and lower costs.37,38 QFPD comprises of several Chinese herbal ingredients. Among these, licorice is one of the most important ingredients, and is a frequently used herb in Chinese formulas.39 Furthermore, licorice, which is also known as the “National Venerable Master”,40 has demonstrated its significant anti-inflammatory and antiviral effects that result from its components, such as gamma-linolenic acid, and its metabolite glycyrrhetinic acid.41 Since acute lung injury is a common clinical symptom after COVID-19 infection, the effects of QFPD in ALI, and its potential mechanisms of activity were investigated through in vivo and in vitro experiments, and network pharmacology.
LPS is a bacterial endotoxin identified in gram-negative bacteria, and this serves as a classical inducer to construct inflammation models.42 LPS-induced CSS models were generated in vitro, and the results revealed that QFPD can inhibit TNF-α and IL6. In addition, the QFPD treatment reduced the inflammation in the lungs, as evidenced by the reduction in neutrophil infiltration and alveolar congestion. Furthermore, the total cell number in BALF significantly decreased after QFPD treatment, confirming the anti-inflammatory effect of QFPD. Therefore, QFPD holds a potential as an effective strategy for the treatment of ALI.
The core targets of QFPD in counteracting ALI were also screened, and several factors, including TNF, EGFR, RELA and NR3C1, were predicted to be the core targets. The excessive production of TNF-α is closely correlated to the evolution of inflammatory illnesses, such as rheumatoid arthritis, inflammatory bowel disease, and acute respiratory distress syndrome (ARDS). Importantly, TNF-α is also crucial in the pathogenesis of COVID-19-associated cytokine storms, and the consequent progression of disease severity.4 Epidermal growth factor receptor (EGFR) is a component of ALI, and serves as the key drug target in auto-inflammatory and auto-immune illnesses.43 In addition, EGFR is associated with viral load, severity, criticality and prognosis in COVID-19 patients.44 Furthermore, RELA and NR3C1 take part in inflammation and viral infections.45,46 Together, these potential targets of QFPD further support its value as an alternative treatment against ALI.
ALI in COVID-19 is characterized by the activation of inflammatory pathways and large amounts of inflammatory factors.47,48 The present GO results suggest that the target genes of QFPD are closely connected to inflammatory response and metabolic processes, including the complement component C5a signaling pathway and its receptor activity. The KEGG results revealed that various inflammatory signaling pathways are involved, including the IL17 signaling pathway, complement, and coagulation cascades. The complement signaling pathway significantly contributes to the systemic inflammatory response. After binding to its receptor, this can activate its effector, and induce the production of inflammatory cytokines.49–52 Through its receptors, IL17 activates various pathways, which consist of NF-κB, MAPKs and C/EBPs, triggering the production of cytokines and chemokines.53 The inflammatory factors and pathways above may be the crucial routes for COVID-19 to induce ALI. Through network pharmacological analysis, C5, C3, C5aR1, TNF and EGFR were identified as the potential targets of QFPD, and further experiments confirmed the requirement of the classical complement pathway for the anti-ALI effects of QFPD. Together, the present study revealed that QFPD may exert anti-ALI effects through multiple targets and pathways.