v
Search
Advanced

Publications > Journals > Journal of Exploratory Research in Pharmacology> Article Full Text

  • OPEN ACCESS

Network Pharmacology Elucidates the Anti-Inflammatory Mechanisms of QingFeiPaiDu Decoction for Treatment of COVID-19

  • Yan Liu#,
  • Lewen Xiong#,
  • Yanyu Wang,
  • Mengxiong Luo,
  • Longfei Zhang*  and
  • Yongqing Zhang* 
 Author information 

Abstract

Background and objectives

QingFeiPaiDu decoction (QFPDD) treatment benefits patients with coronavirus disease 2019 (COVID-19). This study aims to elucidate the mechanisms that underlie the anti-inflammatory effects of QFPDD.

Methods

Based on the clinical symptoms of COVID-19 patients, a component-target-disease network was constructed using the network pharmacology method, and the potential active components, targets, and molecular mechanisms of QFPDD for the treatment of COVID-19 were screened using topology parameter analysis. The best molecules that were affected by QFPDD were validated using Real-Time quantitative polymerase chain reaction (RT-qPCR) in a cellular inflammation model.

Results

In total, 376 active ingredients were identified in QFPDD, and 18,833 potential anti-severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) targets. The principal targets included PIK3CA, PIK3R1, APP, SRC, MAPK1, MAPK3, AKT1, HSP90AA1, EP300, and CDK1. Overall, 574 gene oncology entries and 214 signal pathways were identified. QFPDD affected the cellular response to nitrogen compounds, protein kinase activity, and membrane rafts. QFPDD modulated pathways that are associated with cancer, endocrine resistance, PI3K-Akt signaling, and proteoglycans in cancer. Molecular docking indicated that the core ingredients of QFPDD had a strong binding affinity for SARS-CoV-2 3-chymotrypsin-like cysteine protease (3CLpro) and angiotensin-converting enzyme 2 (ACE2). QFPDD treatment significantly mitigated the lipopolysaccharides-induced five targeted gene transcription in A549 cells.

Conclusions

Our findings preliminarily elucidated that through its active ingredients QFPDD targeted 3CLpro and ACE2 to modulate many factors and pathways that are associated with the pathogenesis of COVID-19. The identified potential molecular mechanism, relevant factors, and key genes QFPDD targeted might help in the design of new and specific antiviral drugs.

Keywords

QingFeiPaiDu decoction, COVID-19, Bioactive ingredients, Molecular mechanism, Network pharmacology, Cell experiment

Introduction

The coronavirus 2019 (COVID-19) pandemic was caused by a severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) infection.1 To date, although several vaccines have been used for the prevention of COVID-19, novel coronavirus variants have spread worldwide. In March 2021, the Delta SARS-CoV-2 variant was identified in India and has now spread to >100 countries. However, there is no clinically effective therapy against the SARS-CoV-2 infection. Of note, traditional Chinese medicine (TCM) has unique advantages in anti-inflammation and control of infectious diseases. The QingFeiPaiDu decoction (QFPDD) is composed of four classic prescriptions of ephedra, apricot kernel, gypsum, and licorice decoction, the Belamcanda and ephedra decoction, the Minor Bupleurum Decoction, and the Powder of Five Ingredients with Poria. A previous study showed that treatment with QFPDD effectively relieved fever, cough, fatigue, and other symptoms in newly diagnosed COVID-19 patients and rapid cleans SARS-CoV-2 to prevent severe disease as well as reduces the mortality rate of hospitalized severe COVID-19 patients.2 Currently, QFPDD has been approved for the treatment of COVID-19 patients by the Chinese government. Therefore, it is of great significance to explore the mechanisms that underlie the action of QFPDD in the treatment of COVID-19.

QFPDD contains 21 TCMs with complicated ingredients, and the clinical efficacy of QFPDD could result from combinational effects of its multi-ingredients that target several molecules and pathways as well as systemic body regulation. To develop new anti-SARS-CoV-2 drugs, a network pharmacological analysis3 was used to explore the active ingredients and potential molecular mechanisms that underlie the anti-inflammatory activity of QFPDD for the treatment of COVID-19, based on the main clinical symptoms of COVID-19 patients. The research workflow is shown in Figure 1.

Illustration of the workflow when studying QFPDD in the treatment of COVID-19.
Fig. 1  Illustration of the workflow when studying QFPDD in the treatment of COVID-19.

Materials and methods

Collection of the active ingredients of QFPDD

Using the Traditional Chinese Medicine Systems Pharmacology (www.tcmspw.com/index.php) and Traditional Chinese Medicines Integrated Database (www.119.3.41.228:8000/tcmid/search), the potential active ingredients of QFPDD were screened, according to the criteria of oral bioavailability (OB) ≥30% and a drug-likeness (DL) ≥0.18. Gypsum fibrosum is a mineral medicine with a relatively simple composition. Gypsum fibrosum was included in the study although it did not meet the criteria.

Prediction of the targets of active ingredients of QFPDD

Using the PubChem database (www.pubchem.ncbi.nlm.nih.gov) and the SwissTargetPrediction database (www.swisstargetprediction.ch), the potential targets for the active ingredients of QFPDD were predicted (eliminated if p = 0 and the target was screened if p>median).

Screening of the main active ingredients and targets of QFPDD

The main active ingredients and targets for QFPDD were screened, according to the average degree of freedom and the maximum degree of freedom. The ingredient–target network diagram was constructed using Cytoscape software (version 3.7.2), and the network topology parameters were calculated using the Cytoscape tools.

Identification of the targets of the major COVID-19 clinical symptoms

The main symptoms of mild COVID-19 patients included fever, cough, and fatigue. The corresponding disease targets were screened using the GeneCards database (www.genecards.org), TTD database (www.db.idrblab.net/ttd), DrugBank database (www.drugbank.ca), DisGeNet database (www.disgenet.org/search) and OMIM database (www.omim.org).

Construction and analysis of the QFPDD-COVID-19-Target network

The main active ingredient targets and disease targets were established as pairs to obtain the potential targets for QFPDD in the treatment of COVID-19. The obtained data were used to construct the QFPDD-COVID-19-Target network using Cytoscape software (version 3.7.2). The topological parameters of the constructed network were analyzed to explore the interaction between different TCMs in QFPDD for the treatment of COVID-19.

Construction and analysis of potential protein–protein interactions

The potential targets of QFPDD in the treatment of COVID-19 were imported into the STRING database (www.string-db.org), and the protein–protein interaction (PPI) network of potential targets was obtained, based on a confidence score of ≥0.9 for the interaction targets. Then, the topology parameters that included each node degree, the betweenness centrality (BC), closeness centrality (CC), average shortest path length (ASPL), and the average values of the potential targets for QFPDD were analyzed using Cytoscape software (version 3.7.2).

Gene Ontology enrichment analysis and Kyoko Encyclopedia of Genes and Genomes pathway analysis

The potential targets of QFPDD for the treatment of COVID-19 were analyzed by Gene Ontology (GO) enrichment analysis, and the potential human signal pathways of the targets involved were analyzed using the DAVID website (www.david.ncifcrf.gov) and Kyoko Encyclopedia of Genes and Genomes (KEGG) database with a p-value of 0.05.

Molecular docking

The three-dimensional (3D) structures of the SARS-CoV-2 3-chymotrypsin-like cysteine protease (3CLpro) (PDB ID: 6LU7) and angiotensin-converting enzyme 2 (ACE2) (PDB ID: 1R42) were downloaded from the RCSB database (www.rcsb.org). The original receptor proteins were extracted, and water molecules, other ligands, and residues were removed using PyMOL 1.7.2.1 software. AutoDock Tools 1.5.6 software was used for hydrogenation, merging of nonpolar and hydrogen interactions, and conversion into PDBQT format. The two-dimensional (2D) or 3D structures of the ligand compounds were downloaded from the PubChem database. The energy of the ligand compounds was minimized and saved in mol2 format with ChemBioOffice 2016 software. All of the flexible bonds of the ligand compounds were rotated by default. The grid box that was used for molecular docking included all the surrounding residues and centered on the primary ligands of the receptor proteins. The molecular docking was performed using Autodock Vina 1.1.2 and a Python script, and the sequences were sorted, according to the optimal affinity of each ligand compound.

Real-Time qPCR verifies the effect of QFPDD on gene expression

Gypsum fibrosum was decocted first, and all the TCMs were decocted twice with 1:8 (weight/weight) of water. The TCM liquid was concentrated to 76 mL, freeze-dried and ground into a fine powder with liquid nitrogen.

Human lung cancer A549 cells were obtained from the Chinese Academy of Sciences Stem Cell Bank. The cells (1 × 105 cells/well) were stimulated with 10 µg/mL lipopolysaccharides (LPS; L8880, Solarbio, Beijing, China) alone or LPS combined with 6.4 mg/mL QFPDD or 0.02 µmol/L Dexamethasone (DXM), for 24 h. The cells were harvested, and their total RNA was extracted, followed by reverse transcription into cDNA using a reverse transcription kit (RR047A, Takara, Beijing, China). The relative levels of the target to the control β-actin mRNA transcripts were quantified by Real-Time quantitative polymerase chain reaction (RT-qPCR) using specific primers (Table 1). The data were analyzed by 2−ΔΔCT.

Table 1

Sequences of primers for RT-qPCR

Target geneForward sequence and reverse sequenceProduct length (bp)
β-actinF: TGACGTGGACATCCGCAAAG204
R: CTGGAAGGTGGACAGCGAGG
SRCF: GCTTCAACTCCTCGGACACC168
R: ACCAGTCTCCCTCTGTGTTGTT
MAPK1F: CCAGGGAAGCATTATCTTGACC172
R: CTTTGGAGTCAGCATTTGGGAA
PRKCDF: AGCACAGAGCGTGGGAAAAC146
R: GTCACCTCAGACACTGGCTCCT
PTK2F: ATCTATCCAGGTCAGGCATCTCT179
R: ATTTCCTGTTGCTGTCGGATTAG
PRKCEF: ATGCCCCCATAGGCTACGAC153
R: CACCCGACGACCCTGAGAG

Statistical analysis

All data are expressed as mean ± standard deviation. Analysis of variance (ANOVA) was used to evaluate the statistical difference in data that met normal distribution and homogeneity of variance. A rank sum test was used when data did not meet a normal distribution or heterogeneity of variance. p>0.05 indicated no statistical difference. p<0.05 indicated statistical difference. p<0.01 indicated a significant difference.

Results

Active ingredients of QFPDD

There were 376 ingredients with an OB ≥30% and a DL ≥0.18 in the 20 TCMs and gypsum fibrosum: Ephedrae Herba (EH) contained 23, Glycyrrhizae Radix et Rhizoma (GRR) 92, Armeniacae by Amarum (ASA) 19, Gypsum Fibrosum (GF) 1, Cinnamomi Ramulus (CR) 7, Alismatis Rhizoma (AR) 10, Polyporus (POL) 11, Atractylodis Macrocephalae Rhizoma (AMR) 7, Poria (POR) 15, Bupleuri Radix (BUP) 17, Scutellariae Radix (SR) 36, Pinelliae Rhizoma (PR) 13, Zingiberis Rhizoma Recens (ZRR) 5, Asteris Radix et Rhizoma (AST) 19, Farfarae Flos (FF) 22, Belamcandae Rhizoma (BR) 17, Asari Radix et Rhizoma (ARR) 8, Dioscoreae Rhizoma (DR) 16, Aurantii Fructus Immaturus (AFI) 22, Citri Reticulatae Pericarpium (CRP) 5, and Pogostemonis Herba (PH) with 11 ingredients (Supplementary Document 1, sheet 1). Because Asteris Radix et Rhizoma and Asari Radix et Rhizoma have the same Latin initials, to distinguish between both TCMs, the first three letters of the first word of Asteris Radix et Rhizoma were used to represent this TCM.

The potential targets of active ingredients in QFPDD

A total of 18,833 targets were predicted by the 376 active ingredients in QFPDD (except for the targets of GF and some active ingredients that had not been identified). The detailed information on the targets of 20 TCMs’ active ingredients in QFPDD is shown in Supplementary Document 2.

Main active ingredients of QFPDD and their potential targets

Many ingredients of QFPDD might be helpful in the treatment of COVID-19; however, the main ingredients of QFPDD were used to elucidate the mechanism that underlies its pharmacological action. An ingredient–target network was constructed (Fig. 2) using these 20 TCMs and their abbreviations in Supplementary Document 1 (sheet 2). According to the ingredient–target network, there were 39 core ingredients and their corresponding targets (Table 2).

Ingredient–target network: (a) EH; (b) GRR; (c) ASA; (d) CR; (e) AR; (f) POL; (g) AMR; (h) POR; (i) BUP; (j) SR; (k) PR; (l) ZRR; (m) AST; (n) FF; (o) BR; (p) ARR; (q) DR; (r) AF; (s) CRP; and (t) PH.
Fig. 2  Ingredient–target network: (a) EH; (b) GRR; (c) ASA; (d) CR; (e) AR; (f) POL; (g) AMR; (h) POR; (i) BUP; (j) SR; (k) PR; (l) ZRR; (m) AST; (n) FF; (o) BR; (p) ARR; (q) DR; (r) AF; (s) CRP; and (t) PH.

The rhomboid node represents the ingredient, and the circular node represents the target. The color of the node represents the degrees of freedom in ascending order from red to yellow to green, and the size of the edge betweenness is denoted by the thickness of the line.

Table 2

Main or core active ingredients and their targets in 20 TCMs

Chinese nameLatin nameNumber of main ingredientsCore ingredientsCore targets
麻黄Ephedrae Herba16diosmetin (EH-10); genkwanin (EH-14); kaempferol (EH-04)CYP19A1
炙甘草Glycyrrhizae Radix et Rhizoma753′-Methoxyglabridin (GRR-63); glypallichalcone (GRR-26); glyasperin B (GRR-18)CYP19A1; PTPN1; ESR2; ESR1
杏仁Armeniacae Semen Amarum17gondoic acid (ASA-13); spinasterol (ASA-08)ESR1; ESR2
桂枝Cinnamomi Ramulus3peroxyergosterol (CR-03); sitosterol (CR-02); beta-sitosterol (CR-01)HSD11B2; CDC25A; NOS2; NR1H2; GLRA1; DHCR7; CDC25B
泽泻Alismatis Rhizoma9alisol,b,23-acetate (AR-04); [(1S,3R)-1-[(2R)-3,3-dimethyloxiran-2-yl]-3-[(5R,8S,9S,10S,11S,14R)-11-hydroxy-4,4,8,10,14-pentamethyl-3-oxo-1,2,5,6,7,9,11,12,15,16-decahydrocyclopenta[a]phenanthren-17-yl]butyl] acetate (AR-08); alisol B monoacetate (AR-03)AR; CES2; CYP17A1; HMGCR; HSD11B1; PTPN1
猪苓Polyporus8(22e,24r)-ergosta-6-en-3beta,5alpha,6beta-triol (POL-03); Cerevisterol (POL-01)AR
白术Atractylodis Macrocephalae Rhizoma3α-Amyrin (AMR-01); (3S,8S,9S,10R,13R,14S,17R)-10,13-dimethyl-17-[(2R,5S)-5-propan-2-yloctan-2-yl]-2,3,4,7,8,9,11,12,14,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-3-ol (AMR-02)CYP19A1; AR; CDC25A
茯苓Poria143beta-Hydroxy-24-methylene-8-lanostene-21-oic acid (POR-09); trametenolic acid (POR-02); dehydroeburicoic acid (POR-14)SHBG; PTPN1; HSD11B1
柴胡Bupleuri Radix133,5,6,7-tetramethoxy-2-(3,4,5-trimethoxyphenyl)chromone(BUP-07); quercetin (BUP-01); areapillin (BUP-08)CYP19A1
黄芩Scutellariae Radix325,8,2′-Trihydroxy-7-methoxyflavone (SR-13); moslosooflavone (SR-28)ESR2
姜半夏Pinelliae Rhizoma10beta-sitosterol (PR-01); gondoic acid (PR-08)ACHE; CYP19A1; ESR2
生姜Zingiberis Rhizoma Recens4beta-sitosterol (ZRR-01); poriferast-5-en-3beta-ol (ZRR-03); stigmasterol (ZRR-02)AR; ACHE; SLC6A2; BCHE; SLC6A4; CHRM2; CDC25A; CDC25B
紫菀Asteris Radix et Rhizoma14quercetin (AST-02); galangin (AST-06)ACHE; CYP19A1
冬花Farfarae Flos8quercetin (FF-01); femara (FF-08); tussilagolactone (FF-06)CDK1
射干Belamcandae Rhizoma15epianhydrobelachinal (BR-10); anhydrobelachinal (BR-06)CYP19A1; CA2
细辛Asari Radix et Rhizoma84,9-dimethoxy-1-vinyl-$b-carboline (ARR-07)CDK1; CDK2; CYP19A1; CA12
山药Dioscoreae Rhizoma10denudatin B (DR-01); kadsurenone (DR-02)CYP19A1; PTPN1; AR
枳实Aurantii Fructus Immaturus20sinensetin (AFI-03)ADORA1
陈皮Citri Reticulatae Pericarpium55,7-dihydroxy-2-(3-hydroxy-4-methoxyphenyl)chroman-4-one (CRP-03); naringenin (CRP-02)ABCG2; ADORA1; ADORA3; CYP19A1; CYP1B1
藿香Pogostemonis Herba7quercetin (PH-01)ADORA1

Targets are associated with clinical symptoms of COVID-19

To explore the molecular mechanism that underlies the action of QFPDD, 9,624 targets that were associated with common COVID-19 clinical symptoms, such as fever, cough, and fatigue were screened from the database (Supplementary Document 1, sheet 3).

QFPDD-COVID-19-Target network

Different TCMs might act synergistically on the same target when treating COVID-19 and enhance the therapeutic efficacy. A network of TCMs and the targets of ≥6 TCMs was generated in Figure 3. Among these targets, 19 TCMs targeted CYP19A1, and 18 targeted ESR2; 15 TCMs shared 3 common targets, and 14 targeted SHBG. In addition, 13 TCMS mutually targeted 4 targets, 12 TCMs shared 9 targets, 11 TCMs targeted 2 targets, 10 TCMs shared13 targets, 9 TCMs had the same 14 targets, 8 TCMs had 14 targets, 7 TCMs had 14 targets, and 6 TCMs shared14 targets. Therefore, TCMs had a multi-ingredient-multitarget feature for the treatment of COVID-19.

QFPDD-COVID-19 Target Network.
Fig. 3  QFPDD-COVID-19 Target Network.

Rhomboid node represents TCMs, the circular node the target, and n = number of types of targets in the same circle to the same amount of TCMs.

PPI network

The potential targets of QFPDD for the treatment of COVID-19 were analyzed using the STRING database, and the PPI network of protein interactions was obtained. Through the calculation of the degree of each node, the BC, CC, and the ASPL, 24 key targets were selected (Table 3).

Table 3

Topological analysis of the QFPDD-COVID-19 Target network

Target nameAbbreviationUniprot IDASPLBCCCDegree
Phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit alphaPIK3CAP423362.1890.0980.45766
Phosphoinositide-3-kinase regulatory subunit 1PIK3R1P279862.2050.0860.45462
Amyloid beta precursor proteinAPPP050672.3580.1660.42455
SRC proto-oncogene, non-receptor tyrosine kinaseSRCP129312.2800.0530.43949
mitogen-activated protein kinase 1MAPK1P284822.1300.0840.47047
mitogen-activated protein kinase 3MAPK3P273612.2240.0420.45043
AKT serine/threonine kinase 1AKT1P317492.2680.0630.44140
heat shock protein 90 alpha family class A member 1HSP90AA1P079002.3110.0650.43338
E1A binding protein p300EP300Q094722.4530.0650.40834
cyclin dependent kinase 1CDK1P064932.6140.0330.38230
Janus kinase 2JAK2O606742.5120.0170.39830
epidermal growth factor receptorEGFRP005332.3700.0410.42229
ThrombinF2P007342.5080.0330.39928
mitogen-activated protein kinase 8MAPK8P459832.2830.0450.43828
retinoid X receptor alphaRXRAP197932.5000.0720.40027
estrogen receptor 1ESR1P033722.3820.0900.42027
protein kinase C deltaPRKCDQ056552.5630.0150.39023
protein tyrosine kinase 2PTK2Q053972.6180.0120.38222
ribosomal protein S6 kinase B1RPS6KB1P234432.4800.0120.40321
mitogen-activated protein kinase 14MAPK14Q165392.5670.0120.39021
nuclear receptor subfamily 3 group C member 1NR3C1P041502.4300.0220.41221
protein kinase C epsilonPRKCEQ021562.5940.0150.38517
cyclin dependent kinase 5CDK5Q005352.6340.0280.38017
peroxisome proliferator activated receptor alphaPPARAQ078692.5870.0310.38715

GO enrichment analysis and KEGG pathway analysis

The GO enrichment analysis of the potential targets of QFPDD for the treatment of COVID-19 revealed 574 GO entries with p<0.05, a minimum count of 3 and an enrichment factor >1.5 (the enrichment factor is the ratio between the observed number and the number expected by chance), which included 353 entries for biological processes, 112 for molecular function, and 109 for cell composition. The top enriched 20 biological process entries in each category are shown in Figure 4a. The KEGG pathway analysis indicated that 214 signal pathways were involved. They included the PI3K-Akt, JAK-STAT, AMPK, NOD-like receptor, NF-κB, Notch, TGF-β, and HIF-1 signal pathways4–15 that are associated with the pathogenesis of pneumonia. The top 20 signal pathways are shown in Figure 4b. There were 196 signal pathways with a p<0.01, and 262 genes were associated with these pathways. Their correlation was established in Figure 5. The 24 critical targets that were identified by network analysis had high degree values. These genes might be the critical target genes of QFPDD for the treatment of COVID-19. According to the statistics on the occurrence of the 24 critical targets in 196 signaling pathways, 24 targets were involved in 156 signal pathways (Fig. 6), which included pathways involved in cancer, endocrine resistance, the PI3K-Akt signal pathway, proteoglycans in cancer, and the Rap1 signal pathway. The Rap1 signaling pathway is crucial for the pathogenesis of acute lung injury or acute respiratory distress syndrome (ALI/ARDS), and the regulation of the Rap1 signaling pathway might become a new strategy for the treatment of ALI/ARDS.16 A diagram of the 24 critical targets for the treatment of COVID-19 is shown in Figure 7.

GO enrichment and KEGG pathway analyses for the potential targets of QFPDD: (a) enrichment analysis of biological processes, molecular functions and cell ingredients; and (b) KEGG pathway analysis.
Fig. 4  GO enrichment and KEGG pathway analyses for the potential targets of QFPDD: (a) enrichment analysis of biological processes, molecular functions and cell ingredients; and (b) KEGG pathway analysis.

The size of the bubble represents the gene count for this line, and the color from blue to red represents the p-values from large to small.

Genes associated with different signal pathways (the size of the nodes represents the size of the degree).
Fig. 5  Genes associated with different signal pathways (the size of the nodes represents the size of the degree).

The degree value of the node in this figure reflects the degree of association between genes and disease treatment, and the node in front of the degree value might be a target gene of interest.

Target–signal pathway.
Fig. 6  Target–signal pathway.

The circular node represents the signal pathway in which 24 key targets participate, and the v-shaped node represents the 24 key targets. The color of the node represents the ascending order of degree from yellow to orange to red to blue.

Twenty-four critical targets for the treatment of COVID-19.
Fig. 7  Twenty-four critical targets for the treatment of COVID-19.

All targets are expressed as the gene name.

Molecular docking results

In total, 375 active ingredients from 20 TCMs (except for GF) in QFPDD were selected and screened for their binding to ACE2 and 2019-nCoV 3CLpro by molecular docking, based on the binding energy. The lower the binding energy, the higher the possibility of binding. The docking results indicated that the binding energies of the 375 main active ingredients were all <0 (except for taraxanthin and delphinidin). The 39 core ingredients screened by the ingredient–target network under 3.3 displayed a good binding affinity to the 3CLpro and ACE2 proteins, and their binding energies were <–3.9. The docking results for each core ingredient for 3CLpro and ACE2 are given in Table 4. To further analyze the interaction between the ingredient and the protein, 2D and 3D molecular docking diagrams exhibited the potential interactions between the ingredient and 3CLpro or ACE2. The molecular docking of the ingredients with the best results is shown in Figure 8. Due to the presence of a hydrophobic Pi-alkyl, the 3′-methoxyglabridin parent nucleus was mainly bound to the amino acid residues CYS145, MET165, and PRO168 of 3CLpro. In addition, hydrogen bonds formed between the phenolic hydroxyl groups on the parent nucleus and the amino acid residues GLY143, LEU141, and CYS145. Due to the presence of the hydrophobic Pi-alkyl, the Alisol B 23-acetate parent nucleus bound to the ACE2 amino acid residues LEU85 and HIS15, and the hydroxyl and carbonyl groups on the parent nucleus formed hydrogen bonds with the amino acid residues GLN101 and ASN103. These interactions might increase the binding of the molecules to the proteins.

Table 4

Docking of the 39 core components with 3CLpro and ACE2

NumberCompoundBinding energy values with 3CLpro (kcal/mol)Binding energy values with ACE2 (kcal/mol)
13′-Methoxyglabridin−8.3−6.1
2Moslosooflavone−7.8−6.0
3Kaempferol−7.7−5.9
4Alisol,b,23-acetate−7.7−6.8
5Quercetin−7.6−6.2
6Peroxyergosterol−7.6−5.8
7Diosmetin−7.6−6.3
8Genkwanin−7.6−5.9
9Epianhydrobelachinal−7.6−6.5
10α-Amyrin−7.5−6.7
11[(1S,3R)-1-[(2R)-3,3-dimethyloxiran-2-yl]-3-[(5R,8S,9S,10S,11S,14R)-11-hydroxy-4,4,8,10,14-pentamethyl-3-oxo-1,2,5,6,7,9,11,12,15,16-decahydrocyclopenta[a]phenanthren-17-yl]butyl] acetate−7.5−6.8
12Areapillin−7.4−6.3
13Naringenin−7.3−5.9
14Glyasperin B−7.3−5.7
155,8,2′-Trihydroxy-7-methoxyflavone−7.2−6.1
16Galangin−7.2−6.0
17Spinasterol−7.1−5.6
18Cerevisterol−7.1−5.6
193beta-Hydroxy-24-methylene-8-lanostene-21-oic acid−7.0−6.3
20Poriferast-5-en-3beta-ol−7.0−5.5
21Stigmasterol−7.0−5.5
22beta-sitosterol−6.9−6.8
23Sinensetin−6.9−5.5
24Dehydroeburicoic acid−6.8−5.8
25Alisol B monoacetate−6.8−6.0
26(22e,24r)-ergosta-6-en-3beta,5alpha,6beta-triol−6.8−5.5
27Glypallichalcone−6.7−5.4
28Femara−6.7−5.3
295,7-dihydroxy-2-(3-hydroxy-4-methoxyphenyl)chroman-4-one−6.6−5.5
30Trametenolic acid−6.6−6.4
313,5,6,7-tetramethoxy-2-(3,4,5-trimethoxyphenyl)chromone−6.5−5.4
32Sitosterol−6.5−5.7
33Tussilagolactone−6.5−4.8
34Denudatin B−6.5−5.4
35Anhydrobelachinal−6.5−5.8
36(3S,8S,9S,10R,13R,14S,17R)-10,13-dimethyl-17-[(2R,5S)-5-propan-2-yloctan-2-yl]-2,3,4,7,8,9,11,12,14,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-3-ol−6.4−5.0
374,9-dimethoxy-1-vinyl-$b-carboline−6.3−5.7
38Kadsurenone−6.1−5.2
39Gondoic acid−4.7−3.9
2D and 3D diagrams of the molecular docking of: (a and b) 3CLpro with 3′-methoxyglabridin; and (c and d) ACE2 with Alisol B 23-acetate.
Fig. 8  2D and 3D diagrams of the molecular docking of: (a and b) 3CLpro with 3′-methoxyglabridin; and (c and d) ACE2 with Alisol B 23-acetate.

The Effect of QFPDD on the levels of mRNA transcripts of SRC, MAPK1, PRKCD, PTK2, and PRKCE

In total, 5 out of 24 key target genes with different degree values were selected to verify the effect of QFPDD on inflammation. As shown in Figure 9, compared with the control group, the relative levels of SRC, MAPK1, PRKCD, PTK2, and PRKCE transcripts increased significantly, which were significantly mitigated in the QFPDD and DXM groups. Of note, the relative levels of SRC and MAPK1 mRNA transcripts in the QFPDD group were slightly higher than those in the DXM group, although they were statistically insignificant.

RT-qPCR analysis of the relative levels of <italic>SRC, MAPK1, PRKCD, PTK2,</italic> and <italic>PRKCE</italic> mRNA transcripts.
Fig. 9  RT-qPCR analysis of the relative levels of SRC, MAPK1, PRKCD, PTK2, and PRKCE mRNA transcripts.

A549 cells were stimulated with or without (control), LPS alone (model) or LPS together with QFPDD or dethamemasone for 24 h and the relative levels of each gene mRNA transcripts were quantified by RT-qPCR. The levels of each gene mRNA transcripts in the control group were designated as 1: (a) levels of SRC mRNA transcripts; (b) levels of MAPK1 mRNA transcripts; (c) levels of PRKCD mRNA transcripts; (d) levels of PTK2 mRNA transcripts; and (e) levels of PRKCE mRNA transcripts **p<0.01 or *p<0.05 compared with the control group; Δp<0.05 compared with the model group, #p>0.05 compared with the DXM group.

Discussion

Network pharmacology is based on the systematic interactions between drugs, targets, and diseases and uses complex network models to determine the pharmacological properties of the research objects.17 The research and development of network pharmacology in TCMs provided a new perspective for the systematic study of the complex ingredients of TCMs.18–20 Therefore, in this study, the target network for QFPDD and COVID-19 was constructed and analyzed, and the targets were used for functional enrichment and signal pathway analysis to reveal the potential molecular mechanisms that underlie the action of QFPDD for the treatment of COVID-19 and to identify the main active ingredients and potential target genes of QFPDD.

Main active ingredients

Previous studies confirmed that SARS-CoV-2, similar to SARS-CoV, binds to ACE2 and causes infection.21 Therefore, the ingredient most closely related to the hydrolase and ACE2 of 2019-nCoV 3CLpro might be the main bioactive ingredient of QFPDD against SARS-CoV-2-induced COVID-19. This study used 20 TCMs (except for GF) from QFPDD to screen 375 major active ingredients and tested their binding to 3CLpro and ACE2 by molecular docking. The results indicated that except for taraxanthin and delphinidin, the remaining ingredients had binding energies <0 when docking with both proteins, which suggested that these ingredients from QFPDD might bind directly to the proteins, which ameliorated SARS-CoV-2 infection-induced COVID-19. The 39 core ingredients identified through network pharmacology had many targets that might improve disease symptoms and could be closely associated with 3CLpro and ACE2. Therefore, the 39 ingredients might be the main bioactive ingredients for the treatment of COVID-19 by QFPDD.

Potential target genes

This study found 24 key targets (PIK3CA, PIK3R1, APP, SRC, MAPK1, MAPK3, AKT1, HSP90AA1, EP300, CDK1, JAK2, EGFR, F2, MAPK8, RXRA, ESR1, PRKCD, PTK2, RPS6KB1, MAPK14, NR3C1, PRKCE, CDK5, and PPARA) for the treatment of COVID-19. Due to their close association, these targets might interact and act synergistically for the pathogenesis of COVID-19. Aberrant SRC activity contributes to the pathogenesis of pneumonia, which represents a potential target for pneumonia treatment.22 MAPK activation modulates the inflammatory response in ALI. MAPK1 activation reduces the LPS-induced inflammatory injury in A549 cells and ameliorates lung injury in ALI mice.23 PRKCD is an important regulator of human neutrophil proinflammatory responses and is crucial to regulate neutrophil–endothelial cell interactions and recruitment in inflamed lungs.24 The activation of members of the PTK family participate in acute inflammatory responses, during ALI and sepsis, and are essential for the recruitment and activation of monocytes, macrophages, neutrophils, and other immune cells.25 PRKCE could be used as a breathing regulator by affecting mitochondrial respiration, which promotes the occurrence of mitochondrial organisms and reduces organ damage that is caused by pneumonia.26 COVID-19 causes severe inflammation and acute lung damage, which leads to severe respiratory distress syndrome. In this study, a cellular model of inflammation was used to verify the relevant targets for QFPDD for inflammation. We found that treatment with QFPDD significantly mitigated the LPS-induced gene expression in A549 cells and that these genes belonged to the 24 potential targets of QFPDD. These findings might help in understanding QFPDD treatment for COVID-19.

Functional enrichment and pathway analysis

The GO functional enrichment analysis revealed the potential targets that were involved in biological processes, molecular function, and cell components.27 The potential targets of QFPDD were enriched in biological processes that included the cellular response to nitrogen compounds and the positive regulation of transferase activity. A previous study showed that the inhibition of nitric oxide (NO) led to an increase in the release of proinflammatory cytokines, deteriorating lung injury, which suggested that NO might ameliorate ALI.28 In addition, QFPDD targeted molecules that were mainly associated with protein kinase activity, protein tyrosine kinase activity, and kinase binding. Experimental results have shown that the mitochondrial antioxidant pathway mediated by protein kinase D1 is crucial for the early stage of bleomycin-induced pulmonary fibrosis in rats.29 Similarly, protein kinase CK2 is related to the prognosis of patients with lung cancer, which suggests that protein kinase CK2 might be a potential target for the treatment of lung cancer.30 In addition, QFPDD targeted cell components that are mainly associated with the membrane, receptor complex, and dendrite. Experiments demonstrated that the lipid raft protein stomatin, in the presence of low oxygen and Dex upregulation stabilized the cytoskeleton that is connected to the membrane and increased the barrier function of lung epithelial cells, which protected lung tissue cells.31 The targets by QFPDD might improve the symptoms of COVID-19 patients through the cellular response to nitrogen compounds, protein kinase activity, and membrane rafts. Therefore, the treatment of COVID-19 by QFPDD might be more closely related to these biological processes.

The KEGG pathway analysis exhibited that the enriched pathways were involved in cancer, the neuroactive ligand-receptor interaction, and the PI3K-Akt signal pathway. The 24 predicted key targets of QFPDD were more closely related to the pathways involved in cancer and proteoglycans in cancer, which suggested that the pathogenesis of COVID-19 might have similar processes to cancer. A recent study demonstrated that the risk of COVID-19 infection in cancer patients was 2.31-fold higher than that of the general population in Wuhan.32 Cancer patients might have a low immune function, which could promote virus infection, or have a poor function in the key target genes, or both. Most of the 24 potential targets of QFPDD were closely related to cancer development.33 carcinogenic signal pathways, which included the PI3K-Akt-mTOR, MAPK-ERK, SRC, CDK4-CDK6, and ER pathways, which are critical for endocrine resistance. Targeting these pathways, especially the ER pathway, could be the most effective way to combat resistance to anti-estrogens, and clinical trials have shown promising results. The PI3K-Akt signal pathway regulates the cellular inflammatory response by stimulating the expression of endothelial nitric oxide synthase (eNOS) and increasing the production of NO to increase vascular permeability, promote the infiltration of inflammatory cells, stimulate the activation of inflammatory cells, and induce the secretion of a large number of inflammatory factors through the activity of NO.34 Studies demonstrated that PI3K inhibitors had a significant inhibitory effect on NO production and inflammatory response in lung tissues of a viral pneumonia mouse model induced by influenza A virus infection.35 In addition to TCMs for COVID-19, some anti-virus (HIV or Ebola) drugs inhibit SARS-CoV-2 replication to ameliorate COVID-19 in the clinic. In this study, we found that 24 genes participated in the signal pathways associated with human immunodeficiency virus infection, which might explain why remdesivir and lopinavir or ritonavir have some benefits to COVID-19 patients.

Future directions

QFPDD is characterized by multiple components, multiple targets, and multiple pathways to treat COVID-19, which could improve the clinical symptoms of patients. The 39 active components, 24 potential key targets, and signaling pathways, such as the PI3K-Akt signaling pathway in QFPDD we found could provide a basis for further study of QFPDD and provide a reference for the development of new drugs for the treatment of COVID-19. In the future, the 39 active ingredients and related signaling pathways should be verified to clarify the material basis and other pharmacological effects of QFPDD for the treatment of COVID-19, such as organ protection, enhancement of immunity, and other functions.

Conclusions

In this study, 39 active ingredients from QFPDD were involved in the treatment of COVID-19 through a network pharmacology analysis, and 24 potential target genes for QFPDD were identified. These were involved in several biological processes and signal pathways, because some ingredients are directly bound to ACE2 and 3CLpro and these targets might be valuable for the treatment of COVID-19. The active ingredients of QFPDD may synergistically target multiple targets to improve clinical symptoms in COVID-19 patients. The 24 potential target genes were primarily involved in inflammatory responses during the pathogenic process of COVID-19 by participating in pathways that are associated with cancer, endocrine resistance, PI3K-Akt signaling, and proteoglycans. Therefore, our findings might provide a foundation for further exploration of QFPDD for the treatment of COVID-19. Further studies are required to verify the material basis-pharmacodynamic evaluation-metabolomics-signaling pathway network to provide an experimental basis for the treatment of COVID-19 with QFPDD and further drug development.

Supporting information

Supplementary material for this article is available at https://doi.org/10.14218/JERP.2021.00011.

Supplementary Document 1

Twenty TCMs’ ingredients or abbreviations and the targets of the major COVID-19 clinical symptoms.

(XLSX)

Supplementary Document 2

The targets of 20 TCMs’ active ingredients in QFPDD.

(XLSX)

Abbreviations

3CLpro: 

3-chymotrypsin-like cysteine protease

ACE2: 

angiotensin-converting enzyme

AFI: 

Aurantii Fructus Immaturus

ALI: 

acute lung injury

AMR: 

Atractylodis Macrocephalae Rhizoma

AR: 

Alismatis Rhizoma

ARR: 

Asari Radix et Rhizoma

ASA: 

Armeniacae by Amarum

ASPL: 

average shortest path length

AST: 

Asteris Radix et Rhizoma

BC: 

betweenness centrality

BR: 

Belamcandae Rhizoma

BUP: 

Bupleuri Radix

CC: 

closeness centrality

COVID-19: 

coronavirus disease 2019

CR: 

Cinnamomi Ramulus

CRP: 

Citri Reticulatae Pericarpium

DR: 

Dioscoreae Rhizoma

EH: 

Ephedrae Herba

FF: 

Farfarae Flos

G: 

FGypsum Fibrosum

GRR: 

Glycyrrhizae Radix et Rhizoma

MAPK1: 

mitogen-activated protein kinase 1

PH: 

Pogostemonis Herba

POL: 

Polyporus

POR: 

Poria

PR: 

Pinelliae Rhizoma

PRKCD: 

protein kinase C delta

PRKCE: 

protein kinase C epsilon.

PTK2: 

protein tyrosine kinase 2

QFPDD: 

QingFeiPaiDu Decoction

SR: 

Scutellariae Radix

SRC: 

SRC proto-oncogene, non-receptor tyrosine kinase

TCM: 

traditional Chinese medicine

ZRR: 

Zingiberis Rhizoma Recens

Declarations

Acknowledgement

None.

Data availability

The datasets used or analyzed during the present study are available from the corresponding author upon reasonable request.

Funding

This work was supported by the key research and development project of Shandong province: demonstration research on key technologies of precision and industrialization of TCM prescription (2016CYJS08A01)

Conflict of interest

The authors declare that they have no conflict of interest.

Authors’ contributions

Study concept and design, analysis and interpretation of data, prepared figures, wrote the manuscript text (YL, LWX); acquisition of data (YYW, MXL); critical revision of the manuscript for important intellectual content, obtained funding (LFZ, YQZ); All authors reviewed the manuscript.

References

  1. Ji JS. Origins of MERS-CoV, and lessons for 2019-nCoV. Lancet Planet Health 2020;4(3):e93 View Article
  2. Zhang L, Zheng X, Bai X, Wang Q, Chen B, Wang H, et al. Association between use of Qingfei Paidu Tang and mortality in hospitalized patients with COVID-19: A national retrospective registry study. Phytomedicine 2021;85:153531 View Article
  3. Hopkins AL. Network pharmacology: the next paradigm in drug discovery. Nat Chem Biol 2008;4(11):682-690 View Article
  4. Li ZP, Chen HJ, Chang SH, Lou Y, Han ZM. Variation of Th17/Treg cell balance and Notch signaling pathway in children with mycoplasmal pneumonia (in Chinese). Chinese Journal of Nosocomiology 2020;30(7):1048-1052
  5. Duan RQ, Li CQ. Effects of azithromycin and montelukast sodium on NOD-like receptor protein-3 inflammatory pathway in children with mycoplasma pneumonia (in Chinese). China Medical Engineering 2019;12:90-92
  6. Tan H, Ji H, Li N, Zhang XJ, Jia Y. Relationship between TGF-β and ERK/GSK3β activation of signaling pathway and radiation-induced mesenchymal transformation of alveolar epithelial cells in rats with radiation-induced pneumonia (in Chinese). Journal of Guangxi Medical University 2019;36(12):1909-1914 View Article
  7. Xue JJ, Shi XX. Expression of TLRs in peripheral blood mononuclear cells of children with mycoplasma pneumonia and its effect on NF-κB/IκBα pathway. Chinese Journal of Health Laboratory Technology 2019;29(20):11-14
  8. Wang TT, Leng CH, Guo KP, Jin SJ. Effect of quercetin on the prevention and treatment of staphylococcus aureus pneumonia in mice and the mechanism of IKK/NF-κB/IκB signaling pathway (in Chinese). Pharmacology and Clinics of Chinese Materia Medica 2019;35(4):53-57
  9. Wang XK. Experimental study on prevention and treatment of radioactive pneumonia by regulating AMPK mediated autophagy by qingfei yiyin prescription [Dissertation] (in Chinese). Beijing:China Academy of Traditional Chinese Medicine 2019
  10. Liu ZM, Sun Y, Gao YC, Long HC, Lei T, Du HJ. Effects of Nomilin on inflammatory response in Klebsiella-induced geriatric pneumonia rats (in Chinese). Chinese Journal of Immunology 2019;35(8):970-975 View Article
  11. Huang P, Guo YH, Xu XL, He SS, Liu QQ. The role of PI3K/Akt/mTOR signaling pathway in the regulation of Treg/Th17 balance in severe pneumonia and the research progress of traditional Chinese medicine (in Chinese). Journal of Emergency in Traditional Chinese Medicine 2018;27(12):183-185
  12. Huang YX. Effect of rhIFN-α1b on RSV infection in rats and the signaling pathways of JAK/STAT and TLR4/NF-κB [Dissertation] (in Chinese). Xi’an:The Fourth Military Medical University 2015
  13. Hui GM. . Effect of qingfei peiyuan granule on IL-17 and JAK-STAT signaling pathways in BALB/c mouse model of immunocompromised lung infection [Dissertation] (in Chinese). Henan University of Traditional Chinese Medicine; 2014
  14. Mei X. Effects of toxin clearance on JAK/STAT signal transduction pathway in lung tissue of rats with phlegm-heat syndrome of pneumonia [Dissertation] (in Chinese). Henan:Henan University of Traditional Chinese Medicine 2010
  15. Guo XK. Study on the role of HIF-1α in the regulation of inflammatory factors by nuclear translocation in severe pneumonia caused by influenza a (H1N1) virus infection [Dissertation] (in Chinese). Shanghai:Shanghai Jiao Tong University 2017
  16. Wang XF, Chen SY, Chen F. Progress in role of Epac/Rap1 signal pathway in acute lung injury (in Chinese). Chinese Journal of Pharmacology and Toxicology 2012;26(5):680-683 View Article
  17. Zhou WX, Cheng XR, Zhang YX. Network pharmacology: a new concept of drug discovery and understanding (in Chinese). Chinese Journal of Pharmacology and Toxicology 2012;26(1):4-9
  18. Zhang WJ, Wang YH. Principle and method of systematic pharmacology and it’s application in traditional Chinese medicine. World Chinese Medicine 2015;10(2):280-286
  19. Zhang YQ, Li S. dvances in network pharmacology and modern research of traditional Chinese medicine (in Chinese). Chinese Journal of Pharmacology and Toxicology 2015;29:883-892
  20. Wang YH, Yang L. Systems Pharmacology-Based Research Framework of Traditional Chinese Medicine (in Chinese). World Chinese Medicine 2013;8(7):801-808
  21. Zhou P, Yang XL, Wang XG, Hu B, Zhang L, Zhang W, et al. A pneumonia outbreak associated with a new coronavirus of probable bat origin. Nature 2020;579(7798):270-273 View Article
  22. Lee D, Gautschi O. Clinical development of SRC tyrosine kinase inhibitors in lung cancer. Clin Lung Cancer 2006;7(6):381-384 View Article
  23. Zhu S, Song W, Sun Y, Zhou Y, Kong F. MiR-342 attenuates lipopolysaccharide-induced acute lung injury via inhibiting MAPK1 expression. Clin Exp Pharmacol Physiol 2020;47(8):1448-1454 View Article
  24. Mondrinos MJ, Zhang T, Sun S, Kennedy PA, King DJ, Wolfson MR, et al. Pulmonary endothelial protein kinase C-delta (PKCδ) regulates neutrophil migration in acute lung inflammation. Am J Pathol 2014;184(1):200-213 View Article
  25. Okutani D. Src protein tyrosine kinase family and acute lung injury (in Japanese). Nihon Rinsho Meneki Gakkai Kaishi 2006;29(5):334-341 View Article
  26. Aslami H, Pulskens WP, Kuipers MT, Bos AP, van Kuilenburg AB, Wanders RJ, et al. Hydrogen sulfide donor NaHS reduces organ injury in a rat model of pneumococcal pneumosepsis, associated with improved bio-energetic status. PLoS One 2013;8(5):e63497 View Article
  27. Wang X, Yin TS, Li BY, Jiang XL, Sun H, Dou YG, et al. Progress of gene function enrichment analysis (in Chinese). Chinese Science: Life Science 2016;46(4):363-373
  28. Qiu HB, Chen DC, Pan JQ. Regulatory effect of inhibition of nitric oxide synthesis on inflammatory response in acute lung injury (in Chinese). Chinese Journal of Emergency Medicine 1999;8(3):153-155 View Article
  29. Ni N. Effect of active vitamin D3 on d1-mediated antioxidant pathway in rat pulmonary fibrosis (in Chinese). Chinese Journal of Anatomy 2016;39:534-538
  30. Li QW. Inhibition of protein kinase CK2 activity enhances radiosensitivity of non-small cell lung cancer and its mechanism [Dissertation] (in Chinese). Hubei:Huazhong University of Science and Technology 2018
  31. Lu J, Chen JC, Cai HY, Ma YY, Wang Y. Expression of lipidin stomatin in rat lung and A549 cells induced by hypoxia or/and glucocorticoid and its effect on cytoskeleton (in Chinese). Chinese Journal of Pathophysiology 2010;10:2072-2072
  32. Yu J, Ouyang W, Chua MLK, Xie C. SARS-CoV-2 Transmission in Patients With Cancer at a Tertiary Care Hospital in Wuhan, China. JAMA Oncol 2020;6(7):1108-1110 View Article
  33. Miller TW. Endocrine resistance: what do we know?. Am Soc Clin Oncol Educ Book 2013;33:e37-e42 View Article
  34. Yin XL, Zhang JY, Liu WD, Duo Jiu HY, Cui H. Sphingosine 1-phosphate receptor 2 mediates PI3K/AKT/eNOS pathway to inhibit viral pneumonia induced by influenza A virus (in Chinese). Chinese Journal of Pathophysiology 2008;34(11):150-155
  35. Yang YL, Tu ML, Xie MS. Effects of PI3K inhibitor on NO production and inflammatory response in lung tissues of viral pneumonia mice induced by influenza a virus FM1 infection (in Chinese). Chinese Journal of Virology 2019;35(5):713-720 View Article

About this Article

Cite this article
Liu Y, Xiong L, Wang Y, Luo M, Zhang L, Zhang Y. Network Pharmacology Elucidates the Anti-Inflammatory Mechanisms of QingFeiPaiDu Decoction for Treatment of COVID-19. J Explor Res Pharmacol. 2021;6(3):71-86. doi: 10.14218/JERP.2021.00011.
Copy        Export to RIS        Export to EndNote
Article History
Received Revised Accepted Published
May 8, 2021 June 30, 2021 July 9, 2021 July 30, 2021
DOI http://dx.doi.org/10.14218/JERP.2021.00011
  • Journal of Exploratory Research in Pharmacology
  • pISSN 2993-5121
  • eISSN 2572-5505
Back to Top

Network Pharmacology Elucidates the Anti-Inflammatory Mechanisms of QingFeiPaiDu Decoction for Treatment of COVID-19

Yan Liu, Lewen Xiong, Yanyu Wang, Mengxiong Luo, Longfei Zhang, Yongqing Zhang
  • Reset Zoom
  • Download TIFF